View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_62 (Length: 203)
Name: NF5270_low_62
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 3303352 - 3303180
Alignment:
| Q |
12 |
catcatcagttgtatgtgaccttgtgaatatgatttagaggtcattttgcttatctatgttattacttattttctatcaggcatgtgcgtgagtgtttaa |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3303352 |
catcatgagttgtatgtgaccttgtgaatatgatttagaggtcattttgcttatctatgttattacttattttctatcaggcatgtgcgtgagtgtttaa |
3303253 |
T |
 |
| Q |
112 |
ggtaacattttgaattttaagaaggaacttagaatctgtgccacaatcctattattatcattcacccactctc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3303252 |
ggtaacattttgaattttaagaaggaacttagaatctgtgccacaatcctattattatcattcacccactctc |
3303180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University