View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5270_low_64 (Length: 201)
Name: NF5270_low_64
Description: NF5270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5270_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 34863847 - 34863679
Alignment:
| Q |
17 |
actattcccctctatcgctctgctccgccgcttgaagttcgactcgaagatttcgaatccttctccatcgatcgtctcagaggtactaatcgcgttctgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863847 |
actattcccctctatcgctctgctccgccgcttgaagttcgactcgaagatttcgaatccttcgccatcgatcgtctcagaggtactaatcgcgttctgc |
34863748 |
T |
|
| Q |
117 |
ttcttcaatttccatggatctgttctatttgtaaccacatgcttctatttctccatgttttcgttccta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863747 |
ttcttcaatttccatggatctgttctatttgtaaccacatgcttctatttctccatgttttcgttccta |
34863679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University