View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5272-Insertion-5 (Length: 286)
Name: NF5272-Insertion-5
Description: NF5272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5272-Insertion-5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 286
Target Start/End: Original strand, 49627869 - 49628141
Alignment:
| Q |
11 |
ttttaattcaaaaccttaaaatataaatttatggatctctcatctatgggtgttccacattcacttttttatccaatgtgagatatattattactcacgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
49627869 |
ttttaattcaaaaccttaaaatataaatttatggatctctcatctataggtgttccacattcacttttttatccaatgtgagatatatta---cttacgc |
49627965 |
T |
|
| Q |
111 |
ttgatgtaccaacaatctccacctcaaatgtgagttcatctattatgtaatatatcccccttaaacgaagttttttcatcaacttataccgccgttaaca |
210 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49627966 |
ttgatataccaacaatctccgcctcaagtgtgagttcatctattatgtaatatatctcccttaaacgaagttttttcatcaacttataccgccgttaaca |
49628065 |
T |
|
| Q |
211 |
gccaccacatcaaccggactcgccatcagaaaatattggtcaggaagactttcgacacaagtagctggtcaaaccc |
286 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49628066 |
gccaccacatcaaccggactcaccgtcagaaaatcttggtcaagaagactttcgacacaagtagctggtcaaaccc |
49628141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University