View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5272-Insertion-6 (Length: 117)
Name: NF5272-Insertion-6
Description: NF5272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5272-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 8839966 - 8839857
Alignment:
| Q |
8 |
caaacgacactccttctttctcatgaagaagaaaatgatcaatgtcttctgaaaccttctcacagataggaggagacttcacagcctcaatggtttctgc |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8839966 |
caaacgacactccttctttctcatgcagaagaaaatgatcaatgtcttctgaaaccttctcacagatagggggagacttcacagcctcaatggtttctgc |
8839867 |
T |
 |
| Q |
108 |
atttccttcc |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
8839866 |
atttccttcc |
8839857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 68
Target Start/End: Original strand, 10627062 - 10627094
Alignment:
| Q |
36 |
aagaaaatgatcaatgtcttctgaaaccttctc |
68 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
10627062 |
aagaaattgatcaatgtcttctgaaaccttctc |
10627094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University