View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5272-Insertion-8 (Length: 191)
Name: NF5272-Insertion-8
Description: NF5272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5272-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 5681716 - 5681533
Alignment:
| Q |
8 |
atattcccatgttgttgtagattttcttcatcttcttgttgatctttgaacaacaattcaggaaaattaaggtttgcagaaggacctctaagataaaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5681716 |
atattcccatgttgttgtagattttcttcatcttcttgttgatctttgaacaacaattcaggaaaattaaggtttgcagaaggacctctaagataaaaca |
5681617 |
T |
|
| Q |
108 |
cagcagtatcataagcacgtgcagcagcaataggtgttatgtaagaacctaaccaaattcttgatcttttgtttggttctctaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5681616 |
cagcagtatcataagcacgtgcagcagcaataggtgttatgtaagaacctaaccaaattcttgatcttttgtttggttctctaa |
5681533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 189
Target Start/End: Original strand, 47038429 - 47038472
Alignment:
| Q |
146 |
atgtaagaacctaaccaaattcttgatcttttgtttggttctct |
189 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
47038429 |
atgtaagaacctaaccatattcttgatcttttatttggttctct |
47038472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University