View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5272_high_20 (Length: 245)
Name: NF5272_high_20
Description: NF5272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5272_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 67 - 168
Target Start/End: Original strand, 36677277 - 36677378
Alignment:
| Q |
67 |
taccaaatgttgcaacaatatgtccctcatactaattcttcataaaacttataaacaatctaacttctctgannnnnnncaacaaccattttgggacatg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
36677277 |
taccaaatgttgcaacaatatgtccctcatactaattcttcataaaacttataaacaatctatcttctctgatttttttcaacaaccattttgggacatg |
36677376 |
T |
|
| Q |
167 |
ta |
168 |
Q |
| |
|
|| |
|
|
| T |
36677377 |
ta |
36677378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 36677477 - 36677529
Alignment:
| Q |
193 |
cacagtttggattagattttaatattttatgacaataattcgagaaaaagctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36677477 |
cacagtttggattagattttaatattttatgacaataattcgagaaaaagctc |
36677529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 95
Target Start/End: Original strand, 37631885 - 37631945
Alignment:
| Q |
35 |
tgcaattaaaagcatttgatcattagaaactctaccaaatgttgcaacaatatgtccctca |
95 |
Q |
| |
|
||||||| ||||||| | ||||||| ||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
37631885 |
tgcaattgaaagcatataatcattataaactttactaaatgatgcaacaatatgtccctca |
37631945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University