View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5272_high_23 (Length: 203)
Name: NF5272_high_23
Description: NF5272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5272_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 29280414 - 29280246
Alignment:
| Q |
17 |
tacttggattcagctgactggaaaatgcgacatgcaggaattacattgctcactgtgatttccaaagagttttctgatgaaatggtgacttcatcataac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29280414 |
tacttggattcagctgactggaaaatgcgacatgcaggaattacattgctcactgtgatttccaaagagttttctgatgaaatggtgacttcatcatagc |
29280315 |
T |
|
| Q |
117 |
tataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280314 |
tataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagt |
29280246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University