View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5273-Insertion-2 (Length: 335)
Name: NF5273-Insertion-2
Description: NF5273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5273-Insertion-2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 8 - 296
Target Start/End: Complemental strand, 28699315 - 28699027
Alignment:
| Q |
8 |
tttcttactctacacataattgtctaattttagttactgcattatttatttgttttgatccccttcatcttcactttcttcaaacaaccaccnnnnnnnn |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
28699315 |
tttcttactctacacataattgtctaattttagttactgcattatttatttgttttgatctccttcatctttactttcttcaaacagccaccttttttct |
28699216 |
T |
 |
| Q |
108 |
cttggtacatttgcttccaattcagctgcaacccttaataattgttctctcagccattcaagttccatttgctgctccacaagctggtcctcaagttcag |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28699215 |
cttggtccatttgcttccaattcagctgcaacccttaataattgttctctcagccattcaagttccatttgctgctccacaagctggtcctcaagttcag |
28699116 |
T |
 |
| Q |
208 |
ccttatcggaaatcacatcatccagaatctccatctgctagtttagaggctaattaatattaaagaattcggctaattaatatggaact |
296 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28699115 |
ccttatcggaaagcacatcatccagaatctccatctgctagtttagaggctaattaatattaaagaactcggctaattaatatggaact |
28699027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University