View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5273_high_1 (Length: 251)
Name: NF5273_high_1
Description: NF5273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5273_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 159 - 236
Target Start/End: Original strand, 41963343 - 41963420
Alignment:
| Q |
159 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagtttagt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41963343 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagtttagt |
41963420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 41963167 - 41963234
Alignment:
| Q |
1 |
ataattctgttggtgtaagtaccgggaatgaggtaaaagtctgtgggtcgcgttcttctttttcttcg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41963167 |
ataattctgttggtgtaagtaccgggaatgaggtaaaagttcgtgggtcgcgttctactttttcttcg |
41963234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 159 - 236
Target Start/End: Original strand, 1224799 - 1224876
Alignment:
| Q |
159 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagtttagt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224799 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagtttagt |
1224876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 1224641 - 1224722
Alignment:
| Q |
1 |
ataattctgttggtgtaagtaccgggaatgaggtaaaagtctgtgggtcgcgttcttctttttcttcgtcttcgaagaaaaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224641 |
ataattctgttggtgtaagtaccgggaatgaggtaaaagttcgtgggtcgcgttcttctttttcttcgtcttcgaagaaaaa |
1224722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University