View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5273_low_2 (Length: 297)
Name: NF5273_low_2
Description: NF5273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5273_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 140 - 288
Target Start/End: Complemental strand, 9424592 - 9424444
Alignment:
| Q |
140 |
ttgacttatagatctcttttatattttgtcacaaaggatgcatgaaacaatagatcatatatattttctgatttacattccattgttacattatatttgg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424592 |
ttgacttatagatctcttttatattttgtcacaaaggatgcatgaaacaatagatcatatatattttctgatttacattccattgttacattatatttgg |
9424493 |
T |
 |
| Q |
240 |
tcatgaagagagaacaaaaacaatagttagcttgagaggaaagtataat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9424492 |
tcatgaagagagaacaaaaacaatagttagcttgagaggaaagtataat |
9424444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 23 - 84
Target Start/End: Complemental strand, 9424896 - 9424836
Alignment:
| Q |
23 |
ataattcaattaccaaactctagcctatgtaccctaaatatacactatataactctataagc |
84 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9424896 |
ataattctattaccaaactctatcctatgtaccctaaatatacactatat-actctataagc |
9424836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University