View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5274_low_4 (Length: 394)
Name: NF5274_low_4
Description: NF5274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5274_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 29402661 - 29402882
Alignment:
| Q |
19 |
cgaggtcaatagagcaaaaagaagggatgagcctgacttttaacttagggaggccaagacaaaattggaataaaacttttttaaaaaagtacaaagctga |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29402661 |
cgaggtcaatagatcaaaaagaagggatgagctttacttttaacttagggaggccaagacaaaattggaataaaacttttttaaaaaagtacaaagctga |
29402760 |
T |
 |
| Q |
119 |
gaaaaagtgttgtgaatttacaaaattgtgtctagttaaaat-------------ttaccacaatttgtcaatgacatgtatataatataataatcaacc |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29402761 |
gaaaaagggttgtgaatttacaaaattgtgtctagttaaaattttgaatttgtaattactacaatttgtcaatgacatgtatataatataataaccaacc |
29402860 |
T |
 |
| Q |
206 |
aaccatgcatatattctttccc |
227 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
29402861 |
acccatgcatatattctttccc |
29402882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 296 - 390
Target Start/End: Original strand, 29402949 - 29403042
Alignment:
| Q |
296 |
gaatgtctctcttttactaatgagaaatcattttatttgnnnnnnnnnnncttcaatttttaaaatgtaacatttgcttctaagtattatctacc |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
29402949 |
gaatgtctctcttttactaatgagaaatcattttatttg-tttttttttccttcaatttttaaaatgttacatttgcttctaagttttatctacc |
29403042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University