View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5274_low_8 (Length: 306)
Name: NF5274_low_8
Description: NF5274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5274_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 36950256 - 36949956
Alignment:
| Q |
1 |
aatgatgcattcacattctggcttgtcgcagttattaagtattggtatttaaatttaaatctactcatttggtgcaatatcaaacatttcatggaaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36950256 |
aatgatgcattcacattctggcttgtcgcagttattaagtattggtatttaaatttaaatctactcatttggcgcaatatcaaacatttcatggaaaaac |
36950157 |
T |
 |
| Q |
101 |
tgaaatgcttctaaacattgcataatatgataaagatatctgattcatgttaatttgtgtgcagtatcagttttgtgtggatggtgtgtggcggcacgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36950156 |
tgaaatgcttctaaacattgcataatatgataaagatatctgattcatgttaatttgtgtgcagtatcagttttgtgtggatggtgtgtggcggcacgat |
36950057 |
T |
 |
| Q |
201 |
gagcagcagccatttataaatgggttcactgacacagtgaacactatttcggtggcagaacaatatatgttacatggaatgactagtagatcagatatgc |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
36950056 |
gagcagcagccatttataaacgggttcactgacacagtgaacactatttcggtggcagaaccatatatgttacatggaatgcctagtagatcacatatgc |
36949957 |
T |
 |
| Q |
301 |
a |
301 |
Q |
| |
|
| |
|
|
| T |
36949956 |
a |
36949956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University