View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_high_12 (Length: 346)
Name: NF5275_high_12
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 79 - 340
Target Start/End: Original strand, 38899802 - 38900063
Alignment:
| Q |
79 |
ggaccaaaaccgttaagagcgatgagtaaagaagcacatcttaaggaaagtttgtcaactatgaactctatcaatggaccgtgtcgtgaagtgggaagct |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38899802 |
ggaccaaaactgttaagagcgatgagtaaagaggcacatcttaaggaaagtttgtcaactatgaactctatcaatggaccatgtcgtgaagtgggaagct |
38899901 |
T |
 |
| Q |
179 |
gagattgaatgtggggtgccatgaatcccctcaatgagggaaaatcaacacactacacacaaaaatagtcgagcaaggctatgtaaatacctactattta |
278 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38899902 |
gagattgaatgtgggatgccatgaatcccctcaatgagggaaaatcaacacactacacgcaaaaatagtcgagcaaggctatgtaaatacaaactatttg |
38900001 |
T |
 |
| Q |
279 |
caaagtatattagacacacaatcaatcaaacacaagttattttcactaactgtatccctatg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38900002 |
caaagtatattagacacacaatcaatcaaacacaagttattttcactaactgtatccctatg |
38900063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University