View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_high_20 (Length: 279)
Name: NF5275_high_20
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 2685872 - 2685627
Alignment:
| Q |
11 |
cagagatgcaacatgatacagattcaatagttttcaatttttcatcaaaccaacacggtgttaactactcgtttaccatcggaaatccatcgattttttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2685872 |
cagagatgcaacatgatacagattcaatagttttcaatttttcatcaaaccaacacggtgttaactactcgtttaccatcggaaatccatcgattttttc |
2685773 |
T |
|
| Q |
111 |
tagactagttgtggattcgggtggtcaacttcaacgtcgaacatggatacaaagtatgaaaacatggacaaatttttggtatgcaccaaaagatcaatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2685772 |
tagactagttgtggattcgggtggtcaacttcaacgtcgaacatggatacaaagtatgaaaacatggacaaatttttggtatgcaccaaaagatcaatgt |
2685673 |
T |
|
| Q |
211 |
gatagttacagagaatgtggtccttatggtttatgtgacacaaatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2685672 |
gatagttacagagaatgtggtccttatggtttatgcgacacaaatg |
2685627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 175 - 258
Target Start/End: Original strand, 36361365 - 36361448
Alignment:
| Q |
175 |
tggacaaatttttggtatgcaccaaaagatcaatgtgatagttacagagaatgtggtccttatggtttatgtgacacaaatgct |
258 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||| ||||| ||| |||||||| | |||| | ||||||||||||||| |
|
|
| T |
36361365 |
tggacaaaattttggtatgcaccaaaagaccaatgtgataattacaaagagtgtggtccatttggtgtgtgtgacacaaatgct |
36361448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University