View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_high_24 (Length: 265)
Name: NF5275_high_24
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 248
Target Start/End: Original strand, 37824464 - 37824698
Alignment:
| Q |
14 |
atatcgcaaacataatcagatatcaagtaaccacttaattcaaacaatttccacatgaacaaaaacagtgtttattaattaactaccgactatagcacta |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37824464 |
atatcacaaacataatcagatatcaagtaaccacttaattcaaacaatttccacatgaacaaaaacagtgtttattaattaactaccgactatagcacta |
37824563 |
T |
|
| Q |
114 |
tagcatatcaaaatttaaacaaatcgctattaatctgcaatacacagactgtagcaccgccgacacatctaattgaggcgtgtcaggtgtctgacatgtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37824564 |
tagcatatcaaaatttaaacaaatcgctattaatctgcaatacacagactgtagcaccgccgacacatctgattgaggcgtgtcaggtgtctgacatgtg |
37824663 |
T |
|
| Q |
214 |
tcggtatccgacatcaacaaacgtgtttaaattga |
248 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |
|
|
| T |
37824664 |
tcggtatccgacatcaacacacttgtttaaattga |
37824698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University