View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_high_29 (Length: 242)
Name: NF5275_high_29
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_high_29 |
 | |
|
| [»] scaffold0299 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 19781515 - 19781286
Alignment:
| Q |
1 |
attcttagtaggagaatgttaaacggtgctcctgaggcattggttaagcaaccaaaacaagtaannnnnnnnataaaaagtggtgtaacttcttagtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19781515 |
attcttagtaggagaatgttaaacagtgctcctggggcattggttaagcaaccaaaacaagtaattttttt-ataaaaagtggtgtaacttcttagtatt |
19781417 |
T |
|
| Q |
101 |
atactgagagtttgtattatccgtctattttttatttctcgtagattatcaagctaatgatatatctctcgatttcaggtaacaatgatggcactattgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781416 |
atactgagagtttgtattatccgtctattttttatttctcgtaaattatcaagctaatgatatatctctcgatttcaggtaacaatgatggcactattgt |
19781317 |
T |
|
| Q |
201 |
tgtgatcccatcatttaagcttgttgatgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19781316 |
tgtgatcccatcatttaagcttgttgatgat |
19781286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 8435025 - 8435080
Alignment:
| Q |
9 |
taggagaatgttaaacggtgctcctgaggcattggttaagcaaccaaaacaagtaa |
64 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
8435025 |
taggagaatgttaaccagtgcccctgaggcattggttaagcatccaaaataagtaa |
8435080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 64
Target Start/End: Original strand, 6830262 - 6830291
Alignment:
| Q |
35 |
aggcattggttaagcaaccaaaacaagtaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6830262 |
aggcattggttaagcaaccaaaacaagtaa |
6830291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 7609685 - 7609630
Alignment:
| Q |
8 |
gtaggagaatgttaaacggtgctcctgaggcattggttaagcaaccaaaacaagtaa |
64 |
Q |
| |
|
||||||||||||||| | ||||||| | |||||||||||||| ||||||| |||||| |
|
|
| T |
7609685 |
gtaggagaatgttaaccagtgctcccggggcattggttaagc-accaaaagaagtaa |
7609630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0299 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0299
Description:
Target: scaffold0299; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 64
Target Start/End: Complemental strand, 18135 - 18107
Alignment:
| Q |
36 |
ggcattggttaagcaaccaaaacaagtaa |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18135 |
ggcattggttaagcaaccaaaacaagtaa |
18107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University