View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_high_30 (Length: 240)
Name: NF5275_high_30
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 58 - 226
Target Start/End: Complemental strand, 28549742 - 28549574
Alignment:
| Q |
58 |
tgtaacattgaaataacaggaaagatatgagaggaatttcatgtacaaattgattatagagtttggtccaaaaaagaagacctgcatctctaggagagac |
157 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28549742 |
tgtaacatgaaaataacaggaaagatatgagaggaatttcatgtacaaattgattatagagtttggtccaaaaaagaagacctgcatctctaggagagac |
28549643 |
T |
 |
| Q |
158 |
gagctcttccactatcaatcgaaaaatttgaatcatgcagttggtacctcaatcgacaacatcttatct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28549642 |
gagctcttccactatcaatcgaaaaatttgaatcatacagttggtacctcaatcgacaacatcttatct |
28549574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 28549794 - 28549759
Alignment:
| Q |
1 |
tgcgacaacaataattgtgtagtaacaacagttaaa |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28549794 |
tgcgacaacaataattgtgtagtagcaacagttaaa |
28549759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University