View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5275_high_32 (Length: 240)

Name: NF5275_high_32
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5275_high_32
NF5275_high_32
[»] chr5 (1 HSPs)
chr5 (24-240)||(8464113-8464330)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 240
Target Start/End: Original strand, 8464113 - 8464330
Alignment:
24 tcataggcggaagagtcatacctcgttggcccgtcccatatatgagctctgccattttatgtggaccatgtggcttgatgcatatgggagggagatgtac 123  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
8464113 tcataggcggaagagtcataccttgttggcccgtcccatatatgagctctgccattatatgtggaccatgtggcttgatgcatatgggagggagatgtac 8464212  T
124 aatacgtcttactctattagttccaattgatcttcttattttaccacataaaagggaaacacgatcaatttagaataaggtcgatgttacaatgtctcgt 223  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||    
8464213 aatacatcttactctattagttccaattgatcttcttattttaccacataaaagggaaacacaatcattttagaataaggttgatgttacaatgtctcgt 8464312  T
224 ttgaagg-tcaattggac 240  Q
    ||||||| ||||||||||    
8464313 ttgaaggatcaattggac 8464330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University