View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5275_high_42 (Length: 214)

Name: NF5275_high_42
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5275_high_42
NF5275_high_42
[»] chr5 (1 HSPs)
chr5 (1-199)||(5462190-5462388)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 5462388 - 5462190
Alignment:
1 ttcacttattaattaaattattttgttgtgactagaaatattgaatagttgaatactactacttgcacttgggataccttgctttctatgaattgagaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5462388 ttcacttattaattaaattattttgttgtgactagaaatattgaatagttgaatactactacttgcacttgggataccttgctttctatgaattgagaca 5462289  T
101 gggttgcattgcattgagaatgggaaaatggttttgtgtgatttgatgggtatgtgtaagtaacaattgggttgggatgatttgataaagcatgtaaaa 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5462288 gggttgcattgcattgagaatgggaaaatggttttgtgtgatttgatgggtatgtgtaagtaacaattgggttgggatgatttgataaagcatgtaaaa 5462190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University