View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_10 (Length: 373)
Name: NF5275_low_10
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 108 - 363
Target Start/End: Original strand, 43221862 - 43222122
Alignment:
| Q |
108 |
tttctgcttgtgccctatttaggttagcagctcaattattttttagagtaactggttattttactatgcagagaagaggtgaatgtgaaaaacaaggcgt |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43221862 |
tttctgcctgtgccctatttaggttagcagctcaattattttttagagtaactggttattttactatgcagagaagaggtgaatgtgaaaaacaaggcgt |
43221961 |
T |
 |
| Q |
208 |
tgagtgcaagcaagtaaatggtggtaatgaagataacgatttggagagtgaagactatatctacaccaactcagtgttaccctagatcaaacacactgct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43221962 |
tgagtgcaagcaagtaaatggtggtaatgaagataacgatttggagagtgaagactatatctacaccaactcagtgttaccctagatgaaacacactgct |
43222061 |
T |
 |
| Q |
308 |
tgcatgtattatgaagtaatttattccttactat-----ttcctctactgaatgatgatgt |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43222062 |
tgcatgtattatgaagtaatttattccttactatttcaattcctctactgaatgatgatgt |
43222122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University