View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_14 (Length: 340)
Name: NF5275_low_14
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 11 - 320
Target Start/End: Original strand, 52807563 - 52807872
Alignment:
| Q |
11 |
cataggttcttcaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatct |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807563 |
cataggttcttgaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatct |
52807662 |
T |
 |
| Q |
111 |
ctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttcaactttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807663 |
ctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttcaactttt |
52807762 |
T |
 |
| Q |
211 |
cacaccctgcaacatcctctacttcatacctcctacgttttgcaccataatttatcttagtagattctgaactttcatagcttccatttatcctccaatt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807763 |
cacaccctgcaacatcctctacttcatacctcctacgtttcacaccataatttatcttagtagattctgaactttcatagcttccatttatcctccaatt |
52807862 |
T |
 |
| Q |
311 |
tgaaagcatc |
320 |
Q |
| |
|
|||||||||| |
|
|
| T |
52807863 |
tgaaagcatc |
52807872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University