View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_24 (Length: 272)
Name: NF5275_low_24
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 100 - 254
Target Start/End: Complemental strand, 6215137 - 6214982
Alignment:
| Q |
100 |
aatgttgttgtacacttctacctttctagtttctacagtcaaacaaacacaataggtttgataaaatatg-aagtccatgcatacacgggattgggattg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6215137 |
aatgttgttgtacacttctacctttctagtttctacagtcaaacaaacacaataggtttgataaaatatggaagtccatgcatacacgggattgggattg |
6215038 |
T |
|
| Q |
199 |
atccttccttctcttcctgtgggccttttctattgataattcccgtggaccttctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6215037 |
atccttccttctcttcctgtgggccttttctattgataattcccgtggaccttctt |
6214982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 6215225 - 6215166
Alignment:
| Q |
14 |
atgtgaatgtgaataaagaacaaagattgaatatttgaaattgaggttccagctcaactag |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
6215225 |
atgtgaatgtgaataaagaacaaagattgaata-ttgaaattgaggttctagctcaactag |
6215166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University