View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_33 (Length: 240)
Name: NF5275_low_33
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_33 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 240
Target Start/End: Original strand, 8464113 - 8464330
Alignment:
| Q |
24 |
tcataggcggaagagtcatacctcgttggcccgtcccatatatgagctctgccattttatgtggaccatgtggcttgatgcatatgggagggagatgtac |
123 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8464113 |
tcataggcggaagagtcataccttgttggcccgtcccatatatgagctctgccattatatgtggaccatgtggcttgatgcatatgggagggagatgtac |
8464212 |
T |
|
| Q |
124 |
aatacgtcttactctattagttccaattgatcttcttattttaccacataaaagggaaacacgatcaatttagaataaggtcgatgttacaatgtctcgt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
8464213 |
aatacatcttactctattagttccaattgatcttcttattttaccacataaaagggaaacacaatcattttagaataaggttgatgttacaatgtctcgt |
8464312 |
T |
|
| Q |
224 |
ttgaagg-tcaattggac |
240 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
8464313 |
ttgaaggatcaattggac |
8464330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University