View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_37 (Length: 230)
Name: NF5275_low_37
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 28550219 - 28550023
Alignment:
| Q |
8 |
aagcaaaggcaaacattgaagatgtgccacattacttaggttcactaaaatcaggaatacctcaacgatggaaagtgagatggcggcgtgtaatttttgc |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28550219 |
aagcataggcaaacattgaagatgtgccacattacttaggttcactaaaatcaggaatacctcaacgatggaaagtgagatggcagcgtgtaatttttgc |
28550120 |
T |
|
| Q |
108 |
ataaaattaactcctattaaagccattaatttgctattaatattccacccttttcgaatgcgatatgaattgaaaacataaccgtaaagcaagcttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
28550119 |
ataaaattaactcctattaaagccattaatttgctattaacattccacccttttcgaatgcaatatgagttgaaaacataaccgtaaagcaagcttg |
28550023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University