View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_39 (Length: 226)
Name: NF5275_low_39
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 47981133 - 47981345
Alignment:
| Q |
1 |
atttcaccaacatagccattttgatttcatcaaacactatacatctttggtacttttgcaccttggttcacatgtcaatatcctccaaagcttatccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47981133 |
atttcaccaacatagccattttgatttcatcaaacactatacatctttggtacttttgcaccttggttcacatgtcaatatcctccaaagcttatccctt |
47981232 |
T |
|
| Q |
101 |
ccctcaaatggaataacctatgaaacttgtcaccttcttcaattcaatggtccaattaatcttttctttctttgaatattactaataaaccgtccttttt |
200 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47981233 |
ccctccaatggaataacctatgacacttgtcaccttcttcaattcaatggtccaattaatcttttctttctttgaatattactaataaaccgtccttttt |
47981332 |
T |
|
| Q |
201 |
acttttccacccc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47981333 |
acttttccacccc |
47981345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 35118527 - 35118441
Alignment:
| Q |
127 |
ttgtcaccttcttcaattcaatggtccaattaatcttttctttctttgaatattactaataaaccgtcctttttacttttccacccc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
35118527 |
ttgtcaccttcttcaattcaatggtccaattcatcttttctctctttgaatattacaaataaaccgtcctttttacttctccacccc |
35118441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University