View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5275_low_5 (Length: 438)
Name: NF5275_low_5
Description: NF5275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5275_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 19 - 430
Target Start/End: Complemental strand, 19781973 - 19781562
Alignment:
| Q |
19 |
cactttccaccctaaacaaagatgtatgagataatcctaaccagttcaccagaaggtcccatgatagcatttgatgcttccaccggtgccacggttgcgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781973 |
cactttccaccctaaacaaagatgtatgagataatcctaaccagttcaccagaaggtcccatgatagcatttgatgcttccaccggtgccacggttgcgc |
19781874 |
T |
 |
| Q |
119 |
agttcactggcagccggtcaccatgtcgtggtctcatggtgacaagccaaggattcattgcagcttcccatgtgtcctcgaacacagggacgggctcgat |
218 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781873 |
tgttcactggtagccggtcaccatgtcgcggtctcatggtgacaagccaaggattcattgcagcttcccatgtgtcctcgaacacagggacgggctcgat |
19781774 |
T |
 |
| Q |
219 |
ccatatttacaattggcacactccaaccgtcttccaaaacatccctctccccgaacctgtggctccactagccgccaccttggatggtgactttctcttt |
318 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781773 |
ccatatttacaattggcacactccaacggtcttccaaaacatccctctccccgaacctgtggctccactagccgccaccttggatggtgactttctcttt |
19781674 |
T |
 |
| Q |
319 |
gcaggtggcgtgtcggggagtatccactccttgtcactcccttccggagatatcatcaaaacatgcactccttactcgaaacctgtttcgagtctccatc |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19781673 |
gcaggtggcgtgtcggggagtatccactccttgtcactcccttccggagatatcatcaaaacatgcactccttactcgaaacctgtttcgagtctccatc |
19781574 |
T |
 |
| Q |
419 |
ttagtgatgatg |
430 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19781573 |
ttagtgatgatg |
19781562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University