View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5276-Insertion-2 (Length: 157)
Name: NF5276-Insertion-2
Description: NF5276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5276-Insertion-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 7 - 155
Target Start/End: Complemental strand, 45267067 - 45266921
Alignment:
| Q |
7 |
atatgcaacaacttgtagtgggtataccccataccagttaatttctttgatgcatcaacttgcagttggtgtgtattaggcagtgatttcacctgaatgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45267067 |
atatgcaacaacttgtagtgggtataccccataccagttaatttctttgatgcatcaacttgcagttggtgtgtattaggcagtgatttcacctcaatgt |
45266968 |
T |
|
| Q |
107 |
actggtcttctagttatatatgtgttgggggataaagtgtgaccctttt |
155 |
Q |
| |
|
||| ||||| |||||||||||||||| | || |||||||||| |||||| |
|
|
| T |
45266967 |
act-gtcttgtagttatatatgtgtt-gaggttaaagtgtgagcctttt |
45266921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University