View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5277-Insertion-11 (Length: 115)
Name: NF5277-Insertion-11
Description: NF5277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5277-Insertion-11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 9e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 9e-43
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 11749093 - 11749200
Alignment:
| Q |
8 |
caaacatgagtaggagacccacttagaagtacttcaagaaagcgagcattcatttttctcgaatcacaaagcaatgcgcaaagcctttgtttgaactcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
11749093 |
caaacatgagtaggagacccacttagaagtacttcaagaaagcgagcattcatttttcctgaatcgcaaagcaacgcacaaagcctttgtttgaactcat |
11749192 |
T |
|
| Q |
108 |
ccggaata |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
11749193 |
ccggaata |
11749200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 7e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 7e-25
Query Start/End: Original strand, 13 - 110
Target Start/End: Original strand, 52011289 - 52011386
Alignment:
| Q |
13 |
atgagtaggagacccacttagaagtacttcaagaaagcgagcattcatttttctcgaatcacaaagcaatgcgcaaagcctttgtttgaactcatccg |
110 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||||||||| ||||||||||||||||||||| | ||| |||| |||||||||||||| |||||||| |
|
|
| T |
52011289 |
atgagtaggaaacccactcagaagtagttcaagaaagcgacaattcatttttctcgaatcacataccaacgcgctaagcctttgtttgagctcatccg |
52011386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 26 - 99
Target Start/End: Original strand, 52001437 - 52001510
Alignment:
| Q |
26 |
ccacttagaagtacttcaagaaagcgagcattcatttttctcgaatcacaaagcaatgcgcaaagcctttgttt |
99 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
52001437 |
ccacttagaagtagttcaagagagtgagcattcatttttcttgaatcacaaagcaacgcgctaagcctttgttt |
52001510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University