View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5277-Insertion-7 (Length: 340)
Name: NF5277-Insertion-7
Description: NF5277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5277-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 34 - 251
Target Start/End: Complemental strand, 43571400 - 43571187
Alignment:
| Q |
34 |
tgccatacataatgtttgtcatgttcagggattatatattatcttgattttctgttttcaaagatggatgtgtgggaagggggattatggaggtaggtat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43571400 |
tgccatacataatgtttgtcatgttcagggattatatattatcttgattttctgttttcaaagatggatgtgtgggaagggggattatggaggtaggtat |
43571301 |
T |
|
| Q |
134 |
ttaattggcatatgaggttgtttgcatggccgggtcaaaatgactaccattaattaaagtgagggctttagacccccaaatattttcgatctcgtattaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| | | |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43571300 |
ttaattggcatatgaggttgtttgcatggccgggtcaaaaggactaccattaa----aataagggttttagacccccaaatattttcgatctcgtattaa |
43571205 |
T |
|
| Q |
234 |
aacccaataaatattttt |
251 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43571204 |
aacccaataaatattttt |
43571187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 244 - 340
Target Start/End: Complemental strand, 43570993 - 43570893
Alignment:
| Q |
244 |
atatttttagctttaaacatacg----gccaaatatgtaaaatgttcgtctctaactttgctacactagaaaaccccaaggctacagctactggtatgct |
339 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43570993 |
atatttttagctttaaacatacgtacggccaaatatgtaaaatgttcgtctctaactttgctacactagaaaaccccaaggctacagctactggtatgct |
43570894 |
T |
|
| Q |
340 |
a |
340 |
Q |
| |
|
| |
|
|
| T |
43570893 |
a |
43570893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University