View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5277-Insertion-8 (Length: 287)
Name: NF5277-Insertion-8
Description: NF5277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5277-Insertion-8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 8 - 287
Target Start/End: Original strand, 8124669 - 8124948
Alignment:
| Q |
8 |
taaagttcagaccttttttgatgatatattcataaacttgttcaattatgtatgtaaagtgcagatatgagagcttgcacttaaataggataaatggtat |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124669 |
taaagttcagaccttttttgatgaaatattcataaacttgttcaattatgtatgtaaagtgcagatatgagagcttgcacttaaataggataaatggtat |
8124768 |
T |
 |
| Q |
108 |
ggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggacctaccatttatgctccacatttagcactacatcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124769 |
ggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggacctaccatttatgctccacatttagcactacatcaa |
8124868 |
T |
 |
| Q |
208 |
ggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatccttctctttggtcattg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124869 |
ggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatccttctctttggtcattg |
8124948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University