View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5277_high_3 (Length: 257)
Name: NF5277_high_3
Description: NF5277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5277_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 147 - 244
Target Start/End: Original strand, 22592216 - 22592313
Alignment:
| Q |
147 |
gcaagaagctttcactgtacctggtaactttgaacttggtcgattggtgtcttgccacacttaaaagcttctgaaatttgatccacatattactaagt |
244 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22592216 |
gcaagaagctttcactgtacttggtaactttgaacttggtcgattggtgtcttgccacacttaaaagcttctgaaatttgatccacatattactaagt |
22592313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 115 - 207
Target Start/End: Complemental strand, 31147400 - 31147305
Alignment:
| Q |
115 |
taagaagcagaaatagtttg--cagactttggtggcaagaagctttcactgtacctggtaacttt-gaacttggtcgattggtgtcttgccacact |
207 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31147400 |
taagaaccagaaatagtttgtgcagactttggtggcaagaagctttcactgtacctggtaactttagaacttggtcgattggtgtcttgccacact |
31147305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 117
Target Start/End: Complemental strand, 31147634 - 31147596
Alignment:
| Q |
79 |
caaggaagtgaacctattaaaattacatactccaactaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
31147634 |
caaggaagtgaacctattaaaattacataatccagctaa |
31147596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University