View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5279-Insertion-2 (Length: 300)
Name: NF5279-Insertion-2
Description: NF5279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5279-Insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 5 - 166
Target Start/End: Original strand, 6356114 - 6356272
Alignment:
| Q |
5 |
acaatatcaatatgtttcaacgttcaagaactatccactggcctagtggatgctcttatacttaggctaatcttgaaattatagaatacgtcactcgtgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6356114 |
acaatatcaatatgtttcaacgttcaagaactatccactggcctagtggttgctcttgtacttaggctaatcttgaaattatagaatacatcactcgtgt |
6356213 |
T |
|
| Q |
105 |
tctgcgtgggttatcgtttgtctttttattagttacatgatgagaggaagataaaaattcgg |
166 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6356214 |
actgcgtgggttatcgttcgtctttttattagttac---atgagaggaagataaaaattcgg |
6356272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 191 - 300
Target Start/End: Original strand, 6357216 - 6357327
Alignment:
| Q |
191 |
aataaataaaaggatcttgttaatgagtgattagctttggcagaataaagctac--tgcatattaatggagatttttaatgtatcaggtaacaacgccga |
288 |
Q |
| |
|
||||||||||| | ||||||||| | |||||||||||||||| ||||||||||| | |||||||||||||| || ||||||||||| |||||||||| | |
|
|
| T |
6357216 |
aataaataaaaaggtcttgttaacgggtgattagctttggcaaaataaagctacactacatattaatggagacttctaatgtatcagataacaacgccaa |
6357315 |
T |
|
| Q |
289 |
cgaaagacaaga |
300 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6357316 |
cgaaagacaaga |
6357327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University