View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5280-Insertion-3 (Length: 227)
Name: NF5280-Insertion-3
Description: NF5280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5280-Insertion-3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 215
Target Start/End: Complemental strand, 19592937 - 19592730
Alignment:
| Q |
8 |
catctttatcacagccacgaccaccaccacaatatttattccatcgaacactatctacaccgcagctaccatcccaatccaatgcaccattttcaacgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19592937 |
catctttatcacagccacgaccaccaccacaatatttattccatcgaacactatctacaccgcagctaccatcccaatccaatgcaccattttcaacgca |
19592838 |
T |
|
| Q |
108 |
acgaccacaaccaccatatcaatttattgcaccatcatattcgtcgcagcagccaccacgaccaccatatcaatttagtcgaccatcattttcgtcgcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
19592837 |
gcgaccacaaccaccatatcaatttattgcaccatcatattcgtcgcagcagccaccacgaccaccatatcattttagtcgaccatcatttttgtcgcaa |
19592738 |
T |
|
| Q |
208 |
ccaccaca |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
19592737 |
ccaccaca |
19592730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 128
Target Start/End: Complemental strand, 19597480 - 19597423
Alignment:
| Q |
71 |
agctaccatcccaatccaatgcaccattttcaacgcaacgaccacaaccaccatatca |
128 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||| |||| | ||||| |||||||||||| |
|
|
| T |
19597480 |
agctaccatcacaatccaatacaccatcttcaccgcagccaccacgaccaccatatca |
19597423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University