View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5280-Insertion-5 (Length: 72)
Name: NF5280-Insertion-5
Description: NF5280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5280-Insertion-5 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 8 - 72
Target Start/End: Original strand, 13347876 - 13347940
Alignment:
| Q |
8 |
catatcgtgacctgcagatcaggtcgtctatctcaaatatcgatgtcgtgttctcagatctcacc |
72 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13347876 |
catatcgtgacctgtagatcaggtcgtctatctcaaatatcgatgtcgtgttctcagatttcacc |
13347940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 39037371 - 39037434
Alignment:
| Q |
8 |
catatcgtgacctgcagatcaggtcgtctatctcaaatatcgatgtcgtgttctcagatctcac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
39037371 |
catatcgtgacctgcagatcaggtcgtctatctcaaatatcgatgtggtgttctcatatctcac |
39037434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 37078796 - 37078735
Alignment:
| Q |
11 |
atcgtgacctgcagatcaggtcgtctatctcaaatatcgatgtcgtgttctcagatctcacc |
72 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37078796 |
atcgtgacctgcagatccagtcgtctatctcaaatatcgatgttgtgttctcagatctcacc |
37078735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University