View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5280-Insertion-6 (Length: 95)
Name: NF5280-Insertion-6
Description: NF5280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5280-Insertion-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 4e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 7 - 94
Target Start/End: Complemental strand, 11059255 - 11059168
Alignment:
| Q |
7 |
aataaacacatattctcatttcttcattttagtattttactacttctcaatattaatttatttactttcctccaggttcaggttctct |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11059255 |
aataaacacatattctcatttcttcattttagtattttactacttctcagtattaatttatttactttccttcaggttcaggttctct |
11059168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University