View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5280-Insertion-7 (Length: 86)
Name: NF5280-Insertion-7
Description: NF5280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5280-Insertion-7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 5e-25; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 5e-25
Query Start/End: Original strand, 7 - 80
Target Start/End: Complemental strand, 26504107 - 26504034
Alignment:
| Q |
7 |
aaaaattgttatcgcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttat |
80 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26504107 |
aaaaattgttatagcaaaaaagatacaaataatgagatgattcatcttcattttgttttgaaaattgaacttat |
26504034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 7e-21
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 26453863 - 26453789
Alignment:
| Q |
7 |
aaaaattgttatcgcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttatc |
81 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||| ||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26453863 |
aaaaattgctatagcaaaaaagatacaaataatgagatgattcatcttcattttattttgaaaattgaacttatc |
26453789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 26521653 - 26521732
Alignment:
| Q |
7 |
aaaaattgttatcgcaaaaaagatataaataatgggatgattcaacttcattttgttttgaaaattgaacttatcgatgg |
86 |
Q |
| |
|
|||||||| ||| |||||||||||| | |||||| ||||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
26521653 |
aaaaattgctatagcaaaaaagatacatataatgagatgattcatcttcattttgttttaaaaattgaacttatcaatgg |
26521732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 35 - 86
Target Start/End: Complemental strand, 26521647 - 26521596
Alignment:
| Q |
35 |
ataatgggatgattcaacttcattttgttttgaaaattgaacttatcgatgg |
86 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
26521647 |
ataatgagatgattcatcttcattttgttttgaaaattgaacttatcaatgg |
26521596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University