View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5281-Insertion-2 (Length: 120)
Name: NF5281-Insertion-2
Description: NF5281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5281-Insertion-2 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 3e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 34493750 - 34493863
Alignment:
| Q |
8 |
cttcatccatgattgcatatgaa-ctttgatgtgaagtttgaaaattcatatgcaaacaaaccagagagacttgaaaagaagataaataacaagatcgga |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
34493750 |
cttcatccatgattgcatatgaatctttgatgtgaagtttgaaaattcatatgcaaacaaaccaaaaagacttgaaaagaagataaataacaaaatcgtt |
34493849 |
T |
 |
| Q |
107 |
aattcgtgaagtaa |
120 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
34493850 |
aattcgtgtagtaa |
34493863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University