View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5282_low_3 (Length: 224)
Name: NF5282_low_3
Description: NF5282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5282_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 31800719 - 31800658
Alignment:
| Q |
20 |
gagtaagagtgtaactaagctatgttttaatgaatttcacattgttgattcaaatagtgtga |
81 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31800719 |
gagtaagagtctaactaagctatgttttaatgaatttcacattgttgattcaaatagtgtga |
31800658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 31800594 - 31800542
Alignment:
| Q |
145 |
cacattattctgtcggattttgattcgatgatgttatatattagtgaactttt |
197 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
31800594 |
cacattattctgtcggatttggatttgatgatgttatatctcagtgaactttt |
31800542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University