View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5284-Insertion-8 (Length: 166)
Name: NF5284-Insertion-8
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5284-Insertion-8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 35341598 - 35341457
Alignment:
| Q |
8 |
ttatagacatccttcgtatgtaaatttatttttggaaaaaatctagtgtggctttagcc-------acaccaaggtttatgatagatccacccgtgcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35341598 |
ttatagacatccttcgtatgtaaatttatttttggaaaaaatctagcgtggctttagcctaaagccacaccaaggtttatgatagatccacccgtgcctc |
35341499 |
T |
|
| Q |
101 |
taatgtcatctttactgagctctagggtctcgaacctttgctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
35341498 |
taatgtcatctttactgagctctagggtcttg-acctttgctt |
35341457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University