View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5284-Insertion-9 (Length: 96)
Name: NF5284-Insertion-9
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5284-Insertion-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 4e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 10536521 - 10536604
Alignment:
| Q |
8 |
ataatatcggtgtctgacaccgacacatatgattgcgttgaactatgttttgttcttaaattattatcggtatctatcagtgtt |
91 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10536521 |
ataatgtcggtgtctgacaccgacacatatgattgcgttgaactatgttttgttcttaaattattatcggtatctatcagtgtt |
10536604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 19637832 - 19637771
Alignment:
| Q |
17 |
gtgtctgacaccgacacatatgattgcgttgaactatgttttgttcttaaattattatcggt |
78 |
Q |
| |
|
||||| ||||||||||||||||||| | ||||| |||| | ||||||||||||||||||| |
|
|
| T |
19637832 |
gtgtccgacaccgacacatatgattacattgaataatgtcattttcttaaattattatcggt |
19637771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.0000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 56049939 - 56049880
Alignment:
| Q |
18 |
tgtctgacaccgacacatatgattgcgttgaactatgttttgttcttaaattattatcggt |
78 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| | |||| |||||||||||||| |
|
|
| T |
56049939 |
tgtctgacaccgacacatatgattacattgaactatgtcat-ttctcaaattattatcggt |
56049880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 78
Target Start/End: Original strand, 19737484 - 19737538
Alignment:
| Q |
24 |
acaccgacacatatgattgcgttgaactatgttttgttcttaaattattatcggt |
78 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| | |||| |||||||||||||| |
|
|
| T |
19737484 |
acaccgacacatatgattgcattgaattatgtaattttctcaaattattatcggt |
19737538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 23 - 78
Target Start/End: Complemental strand, 31026753 - 31026698
Alignment:
| Q |
23 |
gacaccgacacatatgattgcgttgaactatgttttgttcttaaattattatcggt |
78 |
Q |
| |
|
|||||||||| |||||||| | ||||| ||||| | ||||||||||||||||||| |
|
|
| T |
31026753 |
gacaccgacatatatgattacattgaattatgtcattttcttaaattattatcggt |
31026698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University