View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5284_high_18 (Length: 327)
Name: NF5284_high_18
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5284_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 19 - 322
Target Start/End: Complemental strand, 14361964 - 14361661
Alignment:
| Q |
19 |
ttccctaggtataggaattgcaattccaattgctctcacattgacaataatcatcctctttggatcaggcagaaagtacaatgtcttagccaaaccattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361964 |
ttccctaggtataggaattgcaattcccattgctctcacattgacaataatcatcctctttggatcaggcagaaagtacaatgtcttagccaaaccattt |
14361865 |
T |
|
| Q |
119 |
tggtttgcaccactttggtatattcatttagccacgttgggttcatctttcttcatgggtctagctgcatggttagtttgggctgatggtggatttcaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14361864 |
tggtttgcaccactttggtatattcatttagccacgttgggttcatctttcttcatgggtctagctgcttggttagtttgggctgatggtggatttcaag |
14361765 |
T |
|
| Q |
219 |
gtgaaacagatgcattgtctttctatatagcacatgtctctctaagcattgtttggcatccacttgttcttgttatgaatgcttattggcttgcctttgc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14361764 |
gtgaaacagatgcattgtctttctatatagcacatgtctctctaagcattgtttggcatccacttgttcttgttatgaatgcttattggcttgccttggc |
14361665 |
T |
|
| Q |
319 |
ttct |
322 |
Q |
| |
|
|||| |
|
|
| T |
14361664 |
ttct |
14361661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University