View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5284_high_28 (Length: 238)
Name: NF5284_high_28
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5284_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45794177 - 45793957
Alignment:
| Q |
1 |
gcaaagttagtatgtgtatttaatacactgagaagaggtatttttacatttttaatgaataattatcttatttgaaatgcttaaacaatagtaatatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45794177 |
gcaaagttagtatgtgtatttaatacactgagaagaggtatttt-acatttttaatgaataattatcttatttgaaatgcttaaacaatagtcatatagc |
45794079 |
T |
 |
| Q |
101 |
acttgtgagcaaacataattttttgccttgacttgttgcttgacttttggactccggtcgttgtatactaagtcactgaaacaaggtctaggaaggaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794078 |
acttgtgagcaaacataattttttgccttgacttgttgcttgacttttggactccggtcgttgtatactaagtcactgaaacaaggtctaggaaggaaca |
45793979 |
T |
 |
| Q |
201 |
aaataaccagataggagctttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45793978 |
aaataaccagataggagctttt |
45793957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 38362292 - 38362255
Alignment:
| Q |
48 |
atttttaatgaataattatcttatttgaaatgcttaaa |
85 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
38362292 |
atttttaatgaataattatctaatttaaaatgcttaaa |
38362255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University