View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5284_low_28 (Length: 240)
Name: NF5284_low_28
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5284_low_28 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 34908961 - 34909182
Alignment:
| Q |
19 |
aggtacgtgtaagggaaattggtgagggggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttacggggttccacgtatggaagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
34908961 |
aggtacgtgtaagggaaattggtgagggggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttatgggtttccacgtatggaagtt |
34909060 |
T |
|
| Q |
119 |
tcatgcacacgggtcaggtggttttctttagggcacaacagctagattgcttaatttggattgtatagttttcacgtggatgcatatatacttaagaaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34909061 |
tcatgcacacgggtcaggtggttttctttagggcacaacagctagattacttaatttggattgtatagtattcacgtggatgcatatatacttaagaaac |
34909160 |
T |
|
| Q |
219 |
aacaatggtataacatgatatc |
240 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
34909161 |
aacaatgatataacatgatatc |
34909182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 47 - 180
Target Start/End: Original strand, 34902770 - 34902902
Alignment:
| Q |
47 |
ggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttacggggttccacgtatgga-agtttcatgcacacgggtcaggtggttttct |
145 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || |||||||||| | | |||||||||| || ||||||||| ||||||||||| || ||| || |
|
|
| T |
34902770 |
ggttttggtgttttcatggtgtggctatgtttgcttatttgcttgttttatgag-ttccacgtattgacagtttcatgaacacgggtcagttgattt-ct |
34902867 |
T |
|
| Q |
146 |
ttagggcacaacagctagattgcttaatttggatt |
180 |
Q |
| |
|
|| ||||||||||||| ||||| ||||||||| |
|
|
| T |
34902868 |
ttgctacacaacagctagactgcttgatttggatt |
34902902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 47 - 183
Target Start/End: Original strand, 34895254 - 34895388
Alignment:
| Q |
47 |
ggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttacggggttccacgtatggaagtttcatgcacacgggtcaggtggttttctt |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || |||||||||| | ||||||||||| ||||||||| ||||||||| ||| | ||| || |
|
|
| T |
34895254 |
ggttttggtgttttcatggtgtggctatgtttgcttatttgcttgtttta-tgagttccacgtatcacagtttcatgaacacgggtctggt-gatttatt |
34895351 |
T |
|
| Q |
147 |
tagggcacaacagctagattgcttaatttggattgta |
183 |
Q |
| |
|
| |||||||||||| |||||| |||||||||||| |
|
|
| T |
34895352 |
tgctacacaacagctaggttgcttgatttggattgta |
34895388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University