View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5284_low_28 (Length: 240)

Name: NF5284_low_28
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5284_low_28
NF5284_low_28
[»] chr2 (3 HSPs)
chr2 (19-240)||(34908961-34909182)
chr2 (47-180)||(34902770-34902902)
chr2 (47-183)||(34895254-34895388)


Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 34908961 - 34909182
Alignment:
19 aggtacgtgtaagggaaattggtgagggggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttacggggttccacgtatggaagtt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||    
34908961 aggtacgtgtaagggaaattggtgagggggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttatgggtttccacgtatggaagtt 34909060  T
119 tcatgcacacgggtcaggtggttttctttagggcacaacagctagattgcttaatttggattgtatagttttcacgtggatgcatatatacttaagaaac 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||    
34909061 tcatgcacacgggtcaggtggttttctttagggcacaacagctagattacttaatttggattgtatagtattcacgtggatgcatatatacttaagaaac 34909160  T
219 aacaatggtataacatgatatc 240  Q
    ||||||| ||||||||||||||    
34909161 aacaatgatataacatgatatc 34909182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 47 - 180
Target Start/End: Original strand, 34902770 - 34902902
Alignment:
47 ggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttacggggttccacgtatgga-agtttcatgcacacgggtcaggtggttttct 145  Q
    |||||||||||||| ||||||||||||||||||||| || |||||||||| | | |||||||||| || ||||||||| ||||||||||| || ||| ||    
34902770 ggttttggtgttttcatggtgtggctatgtttgcttatttgcttgttttatgag-ttccacgtattgacagtttcatgaacacgggtcagttgattt-ct 34902867  T
146 ttagggcacaacagctagattgcttaatttggatt 180  Q
    ||    ||||||||||||| ||||| |||||||||    
34902868 ttgctacacaacagctagactgcttgatttggatt 34902902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 47 - 183
Target Start/End: Original strand, 34895254 - 34895388
Alignment:
47 ggttttggtgttttgatggtgtggctatgtttgcttcttggcttgttttacggggttccacgtatggaagtttcatgcacacgggtcaggtggttttctt 146  Q
    |||||||||||||| ||||||||||||||||||||| || ||||||||||  | |||||||||||   ||||||||| ||||||||| ||| | ||| ||    
34895254 ggttttggtgttttcatggtgtggctatgtttgcttatttgcttgtttta-tgagttccacgtatcacagtttcatgaacacgggtctggt-gatttatt 34895351  T
147 tagggcacaacagctagattgcttaatttggattgta 183  Q
    |    |||||||||||| |||||| ||||||||||||    
34895352 tgctacacaacagctaggttgcttgatttggattgta 34895388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University