View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5284_low_31 (Length: 234)
Name: NF5284_low_31
Description: NF5284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5284_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 31482734 - 31482527
Alignment:
| Q |
16 |
atcatttggaaaatatgaaaatttataaccaaacgcatctactatctcttgaacaatagtttcaatctcttcattttctggcctgaaagtataaaagatt |
115 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31482734 |
atcatttggaagatatgaaaatttgtaaccaaacgtctccactatctctttaacaatagtttcaatctcttcattttctggcctgaaagtataaaagagt |
31482635 |
T |
 |
| Q |
116 |
taaccataaatctgcatatcttgaacaatcattttattcttttagaaaactctagtttgaagagggaaattaaatcatcattcact-gatctgttagtca |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||| ||||| ||| ||||||||||||| |
|
|
| T |
31482634 |
taaccataaatctgcatatcttgaagaatcattttattc--ttagaaaactctagtttgaagagggaaagtaaatcgtcatttactagatctgttagtca |
31482537 |
T |
 |
| Q |
215 |
aagcttaaaa |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
31482536 |
aagcttaaaa |
31482527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University