View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5285-Insertion-4 (Length: 300)
Name: NF5285-Insertion-4
Description: NF5285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5285-Insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 95 - 232
Target Start/End: Original strand, 34439202 - 34439348
Alignment:
| Q |
95 |
gtgatttagatgatgattatcaaaagggga---------accactctttattaaaaggaatatgggaccgatggccacatatgcaagttgcttttcccat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34439202 |
gtgatttagatgatgattatcaaaaggggattgacccgaaccactctttattaaaaggaatatgggaccgatggccacatatgcaagttgcttttcccat |
34439301 |
T |
|
| Q |
186 |
tgctatatctgcctccccatcctatgtctctttctattttctgttag |
232 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34439302 |
tgccatatctgcctccccatcctatgcctctttctattttctgttag |
34439348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 290
Target Start/End: Original strand, 34440088 - 34440129
Alignment:
| Q |
249 |
tcaatctcatgttgtagctggtgagaacttaatggctaactt |
290 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34440088 |
tcaatctcatgtggtagctggtgagaacttaatggctaactt |
34440129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University