View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5285_low_18 (Length: 220)
Name: NF5285_low_18
Description: NF5285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5285_low_18 |
 | |
|
| [»] scaffold1322 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1322 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold1322
Description:
Target: scaffold1322; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 201
Target Start/End: Complemental strand, 1296 - 1106
Alignment:
| Q |
11 |
cgaagaatattacaaagtctcatggcaagaaaagcaagaacgaaccatctataaagcttagccgaagtgatttccgtcaaaccgaattgtgtgaccatcg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1296 |
cgaaaaatattacaaagtctcatggcaagaaaagcaagaatgaaccatctataaagcttagccgaagtgatttccgtcaaaccgaattgtgtgaccatcg |
1197 |
T |
|
| Q |
111 |
gcttaatggtttaaacaaatgatcatttgttattcttgcaattctttctaatccacgttcataaaatttcaccactcccaaacccgtcatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
1196 |
gcttaatggtttaaacaaatgatcatttgttattcttgcaattcttgctaatccacattcataaaatttcgcaactcccaaacccgtcatg |
1106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 14322047 - 14321862
Alignment:
| Q |
16 |
aatattacaaagtctcatggcaagaaaagcaagaacgaaccatctataaagcttagccgaagtgatttccgtcaaaccgaattgtgtgaccatcggctta |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
14322047 |
aatattacaaaatctcatggcaagaaaagcaagaatgaaccatctataaagcttagccgaagtgatttccatcaaaccgaattgtgcgaccatcggctta |
14321948 |
T |
|
| Q |
116 |
atggtttaaacaaatgatcatttgttattcttgcaattctttctaatccacgttcataaaatttcaccactcccaaacccgtcatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| || || ||||||||| | ||||||||||| |||||| |
|
|
| T |
14321947 |
atggtttaaacaaatgatcatttgttattcttgcaattcttgctaatctacatttataaaattttgcaactcccaaacctgtcatg |
14321862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University