View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5287_low_3 (Length: 327)
Name: NF5287_low_3
Description: NF5287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5287_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 314
Target Start/End: Complemental strand, 18014632 - 18014331
Alignment:
| Q |
10 |
gttctttagtacctaagtttcttccctttttttatttatttataatttatcaatacacatgtggnnnnnnnnattcgaaaattacac--gtgatatccta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
18014632 |
gttctttagtacctaagtttcttccctttttttatttatttataatttatcaatacacatgtggttttttt-attcgaaaattacacatgtgatatccta |
18014534 |
T |
|
| Q |
108 |
ctcatttaagtgaggtgtcacatatcaactgacttcgtcaaaataaaagggaaagacaacttttacaaaagggaataaatatagaataccacgttcgtca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
18014533 |
ctcatttaagtgaggtgtcacatatcaactaacttctttaaaataaaagggaaagacaacttttacaaaagggactaaatatagaagaccacgttcgtca |
18014434 |
T |
|
| Q |
208 |
ttttttaataggggccaaaatcacaagattaaaagttacgagttcaaaattgctgaaaaatcatttcaaaatatgagggttttcttgcatgtgcatactc |
307 |
Q |
| |
|
|| |||||||||||||||||| |||||||| |||||||| || ||||||||||| ||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
18014433 |
ttctttaataggggccaaaattacaagatttaaagttacaaggtcaaaattgctaaaaaaccatttcaaaatatgagggt----ttgcatgtgcacactc |
18014338 |
T |
|
| Q |
308 |
tgatccc |
314 |
Q |
| |
|
||||||| |
|
|
| T |
18014337 |
tgatccc |
18014331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University