View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5288_high_14 (Length: 351)
Name: NF5288_high_14
Description: NF5288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5288_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 143 - 295
Target Start/End: Original strand, 24582342 - 24582494
Alignment:
| Q |
143 |
gtattatacatagatgtttgtc---tatctgagttagttaagatgatagtggtcttatctccttnnnnnnnntataaaaatagtggtcttgtatcttctt |
239 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
24582342 |
gtattatacatagatgtttgtcgtctatctgagttagttaagatgat---gatcttatctccttaaaaaaaatataaaaatagtggtcttatatcttctt |
24582438 |
T |
|
| Q |
240 |
aatttaggttcaaatctagagtgaacttgtttaagcgaaaagttattatcaatttg |
295 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
24582439 |
aatttaggttcaaatctagagcgaatttgtttaagcgaaaagttattaccaatttg |
24582494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 24582210 - 24582268
Alignment:
| Q |
8 |
tttggtgttagttaatgagtgatatgcataagaagttaagctttacatggtcggcaggg |
66 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24582210 |
tttggtgttagttaataagtgatatgcataagaagttaagctttacatggtcggcaggg |
24582268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University