View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289-Insertion-2 (Length: 340)
Name: NF5289-Insertion-2
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289-Insertion-2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 25 - 169
Target Start/End: Complemental strand, 41125271 - 41125127
Alignment:
| Q |
25 |
ggaaaggagggaacctcctggggaaatgctgagatctgcattgcagtcacagaaatttcactgtggaagcagaaaagagcggtgcgtaattcgaactata |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41125271 |
ggaaaggagggaacctcctggggaaatgctgagatctgcattgcagtcacagaaatttcactgtggaagcagaaaagagcggtgcgtaattcaaactata |
41125172 |
T |
|
| Q |
125 |
taagaaggagcgtcacattgctgaggtttgcgacaacatgataac |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125171 |
taagaaggagcgtcacattgctgaggtttgcgacaacatgataac |
41125127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 231 - 325
Target Start/End: Complemental strand, 41122956 - 41122862
Alignment:
| Q |
231 |
acttccgaaatttagttgacaacaactttgtaacatgatgaggacaccatgcatgaatcaaccaccatcgatattcaggttttctttttaattga |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41122956 |
acttccgaaatttagttgacaacaactttgtaacatgatgaggacaccatgcatgaatcaaccaccatcaatattcaggttttctttttaattga |
41122862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 25 - 175
Target Start/End: Complemental strand, 39443371 - 39443218
Alignment:
| Q |
25 |
ggaaaggagggaacctcctggggaaatgctgagatctgcattgcagtcaca---gaaatttcactgtggaagcagaaaagagcggtgcgtaattcgaact |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39443371 |
ggaaaggagggaacctcctggggaaatgctgagatctgcattgtagtcacaaaagaaatttcgctgtggaagcagaaaagagcggtgcgtaattcaaact |
39443272 |
T |
|
| Q |
122 |
atataagaaggagcgtcacattgctgaggtttgcgacaacatgataaccccctg |
175 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
39443271 |
atataagaaggagcgtcacactgctaaggtttgcgacaacatgataaccccctg |
39443218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 231 - 325
Target Start/End: Complemental strand, 39443162 - 39443068
Alignment:
| Q |
231 |
acttccgaaatttagttgacaacaactttgtaacatgatgaggacaccatgcatgaatcaaccaccatcgatattcaggttttctttttaattga |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||| |||||||||||||||| |
|
|
| T |
39443162 |
acttccgaaatttagttgacaacaactttgtaacatgatgaggacaccatgcatgaatcaaccgctgtcaatattcagtttttctttttaattga |
39443068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 262 - 294
Target Start/End: Original strand, 19703681 - 19703713
Alignment:
| Q |
262 |
aacatgatgaggacaccatgcatgaatcaacca |
294 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
19703681 |
aacatgatgaggacaccatacatgaatcaacca |
19703713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University