View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5289-Insertion-3 (Length: 310)
Name: NF5289-Insertion-3
Description: NF5289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5289-Insertion-3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 8 - 139
Target Start/End: Original strand, 3849388 - 3849519
Alignment:
| Q |
8 |
cttctcttagtatataagattgctggattgagtagttctaggtgatctcttgcaaaatcagccttccnnnnnnnnnnnnnnncttgtgtctccatgttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3849388 |
cttctcttagtatataagattgctggattgagtagttctaggtgatctcttgcaaaatcagccttccttttttgatttttttcttgtgtctccatgttga |
3849487 |
T |
 |
| Q |
108 |
agcacgtgattatcttcttttgttggaagaag |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3849488 |
agcacgtgattatcttcttttgttggaagaag |
3849519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University